Distribute the code worksheets (each code half a sheet in the attachment) and pencils. Make sure that students sitting near to each other do not have the same code.
Explain how to fill in the code sheets:
Find the lines of code at the bottom of your sheet, made up of Ws and Ps. You will use these to fill in the boxes of the grid. If you read a P you will fill in the square with pencil; if you read a W you will leave the square white.
So for example, looking at Code B, the first letter in the first block of code is W, so leave the top left box of the grid white. The next code letter is P, so shade in the next square in that row with pencil. The following square will be shaded with pencil, and the one after that will be white. And so on. It is helpful to cross out the code letters one by one as the boxes are filled in.
Once the first block of code is all crossed out, the first row of boxes should be completed. The next block of code corresponds to the next row of boxes. The eight blocks of code will fill up all eight rows of the grid.
Circulate while the students fill in their grids, to make sure that they are aligning the blocks of code and the rows of the grid.
As students complete their grids, they will see a (pixellated) shape of a living thing. Students will discover that sometimes they get the same shape as someone else. Once all students have filled in their grid, ask what shapes they made.
(The last sheet of the code worksheet informs the teacher of the shapes that the students should make with each code.)
Sometimes a student will make an error - this can also be used for discussion on what happens when there is an error in a DNA sequence - see Closure Discussion following.
Closure Discussion:
Just as the letters of the code in our activity could make many different living things, the DNA code in all living things can give rise to the variety of living things.
The code in our activity had just two letters and was only 70 units long. We were able to make several different shapes from it and you can imagine many more shapes that could be make with these letters and this grid. DNA has 4 letters and in people is 3 billion units long, so there are many, many more ways that the letters can be arranged, making many, many different kinds of instructions possible, so giving rise to a huge variety of living things.
If a student made an error in their code and did not get a recognizable picture, use this to discuss what happens with DNA: when DNA is copied, sometimes an error is made, and the wrong letter appears in the DNA sequence. When this happens the instructions are changed, and the living thing may not survive, or may have a disorder.
If students are keen and able, information on DNA code can become more detailed:
The four different units in DNA are called A, C, G and T (they may be familiar to some students). The units are joined together in a long string, for example AATTCGTCGTTAATCTGATC, and so on, 3 billion of them in people.
Each of us has a slightly different order of these four units, so our instructions are a little different, so we look a little different from each other: our hair colour, whether we are a boy or a girl etc. But, all of our instructions are similar enough that we are all people.
Other living things have the same 4 letters, but in another order, so the instructions are different enough to make a different living thing.
Our instructions are quite similar to apes, so we are fairly similar to the apes. Our instructions are very different from a tree, so we look quite different from a tree. However, we do have some internal chemistry in common with a tree, so some of our instructions are even the same as a tree!
Scientists study the order of the As, Cs, Gs and Ts in different living things to understand how they are related to each other and how living things evolved.
