ingridscience

Using a paint stick (good for lower primaries)
The fulcrum can be a pencil or short dowel. Find the balance point for different sized balls of play dough on each end. Younger students can add in lego or other classroom objects. Give a set of challenges (see photo) and/or Encourage investigation with questions: How does moving the fulcrum change how they balance? Can a small ball lift a large ball? How small can a small ball be to do this? Where does the fulcrum have to be to make them balance each other?
Discuss the pushes and pulls that keep it balanced: gravity pulls on the weights, to make them push down on the stick. When the pushes on each side of the balance point are equal, the stick will balance.

Using a ruler, and adding measuring
The same activity as with the paint stick can be conducted with a ruler, and the markings used to record how far a mass is from the centre and how this affects the balance point. Graph the results and the points should make a straight line (though data will be more messy than this). To graph the data from multiple students on one graph, make sure they have the same sized play dough.

More free exploration
Students can also use paint sticks and be given additional materials to try lever free experimentation, for some less structured exploration of levers and balancing, probably best done after these more structured activities, to ensure some focus.

Using a long stick
More dramatic, but more chaotic with many long sticks in use.

Balance the stick on one finger.
The balance point should be half way along.
This is because the mass of the stick is the same on each side, so gravity pulls down on each side with equal force. As the stick is an even width, the balance point will be in the centre.

A trick to find the balance point of any stick:
Start with the stick resting on a finger at each end, then slowly slide the fingers together along the underside of the stick. The rod will slide over the fingers, then stop moving over them, in turn, as the weight on each finger changes. The fingers will end up meeting at the balance point in the middle of the stick. See http://www.exploratorium.edu/snacks/center-gravity

Now add some play dough to one end of the stick, and find the new balance point.
It should be nearer the weight.

Now experiment with adding different sizes of play dough to different places along the stick.
The balance point will move depending on the relative weights and their positions out on the stick.
The lighter weights need a longer length of stick to balance a heavier weight. The further out the mass is, the greater force it exerts (actually torque as the force is exerted on a rotating lever arm). The mass has more of an effect when it is further away (the torque is greater).
Students can draw what they find in each case (see photo and attached worksheet).

Students are taken to an outside location with a variety of ecosystems e.g. small pond, rotting wood area (see image of rotting wood with animals and fungi on it).
Lay out nets, droppers, and collecting buckets in a central area.
Review the kingdoms of life and the living things that are in each - use an evolutionary tree poster if you have one.
Give each student a tray with compartments. Ask them to find examples of each kingdom and put them in each well of the tray.

Examples that they might find:
Animals - pond organisms, insects, worms, wood bugs, snails.
Plants - any leaf, moss, pond plants such as duck weed.
Fungi - white filaments on rotting log, mushrooms. Fungi have a distinctive smell.
Protists - pond algae, pond single celled organisms recovered with algae e.g. Paramecium.
Eubacteria - in dirt, our bodies
Archaea - in the soil, as well as other more extreme environments that are hot, salty or acidic
(note Monera is an old kingdom, that has now been split into Eubacteria and Archaea).

The tray in the image contains:
Daphnia from the pond (animal)
Clover leaf (plant)
Rotting wood (contains fungi)
Pond algae (protist)
Soil (monera)

Distribute the code worksheets (each code half a sheet in the attachment) and pencils. Make sure that students sitting near to each other do not have the same code.

Explain how to fill in the code sheets:
Find the lines of code at the bottom of your sheet, made up of Ws and Ps. You will use these to fill in the boxes of the grid. If you read a P you will fill in the square with pencil; if you read a W you will leave the square white.
So for example, looking at Code B, the first letter in the first block of code is W, so leave the top left box of the grid white. The next code letter is P, so shade in the next square in that row with pencil. The following square will be shaded with pencil, and the one after that will be white. And so on. It is helpful to cross out the code letters one by one as the boxes are filled in.
Once the first block of code is all crossed out, the first row of boxes should be completed. The next block of code corresponds to the next row of boxes. The eight blocks of code will fill up all eight rows of the grid.

Circulate while the students fill in their grids, to make sure that they are aligning the blocks of code and the rows of the grid.
As students complete their grids, they will see a (pixellated) shape of a living thing. Students will discover that sometimes they get the same shape as someone else. Once all students have filled in their grid, ask what shapes they made.
(The last sheet of the code worksheet informs the teacher of the shapes that the students should make with each code.)
Sometimes a student will make an error - this can also be used for discussion on what happens when there is an error in a DNA sequence - see Closure Discussion following.

Closure Discussion:
Just as the letters of the code in our activity could make many different living things, the DNA code in all living things can give rise to the variety of living things.
The code in our activity had just two letters and was only 70 units long. We were able to make several different shapes from it and you can imagine many more shapes that could be make with these letters and this grid. DNA has 4 letters and in people is 3 billion units long, so there are many, many more ways that the letters can be arranged, making many, many different kinds of instructions possible, so giving rise to a huge variety of living things.
If a student made an error in their code and did not get a recognizable picture, use this to discuss what happens with DNA: when DNA is copied, sometimes an error is made, and the wrong letter appears in the DNA sequence. When this happens the instructions are changed, and the living thing may not survive, or may have a disorder.

If students are keen and able, information on DNA code can become more detailed:
The four different units in DNA are called A, C, G and T (they may be familiar to some students). The units are joined together in a long string, for example AATTCGTCGTTAATCTGATC, and so on, 3 billion of them in people.
Each of us has a slightly different order of these four units, so our instructions are a little different, so we look a little different from each other: our hair colour, whether we are a boy or a girl etc. But, all of our instructions are similar enough that we are all people.
Other living things have the same 4 letters, but in another order, so the instructions are different enough to make a different living thing.
Our instructions are quite similar to apes, so we are fairly similar to the apes. Our instructions are very different from a tree, so we look quite different from a tree. However, we do have some internal chemistry in common with a tree, so some of our instructions are even the same as a tree!
Scientists study the order of the As, Cs, Gs and Ts in different living things to understand how they are related to each other and how living things evolved.

Lay out the plants for students to see.
Provide activities and discussion around root shapes and functions:
Sort the plants by root length.
Discuss how the longer roots might be able to get water from further down than the shorter roots. Discuss how the widely branched roots might be able to gather water from further sideways. Discuss how each kind of root anchors the plant in the soil.
Draw some differing root shapes.

If possible, take students outside to a place with bushes. Give them each a dropper bottle filled with water and a worksheet.
Ask them to drip individual drops on leaves and watch what happens to the drips:
First compare how quickly the water soaks into the leaf compared to their clothing made of different fabrics.
Then if the water runs off the leaf, draw the path of the water for different leaf shapes, then . Record on the worksheet.

Indoors, tape cut branches into trays so that they hang over the tray.
Students drip water onto the leaves and watch where the drips go, and whether they soak in.
Record on a worksheet.

Outside or indoors, give students modelling clay, to mimic heavy snow. They wrap the clay around stems to see if the stems bend or break.

Discussion of discoveries:
Usually dripped water stays as a drop, and flows off the leaf via the pointed drip tip (if the leaf has one), sometimes after it has fused with other drops. The drops do not soak into the leaf.
The drip tips divert water off the leaf, so that bacteria and fungus does not have a place to grow.
The waxy coating forms a physical barrier that resists penetration by virus particles, bacteria and fungi. It also prevents water loss from the leaf.
Evergreen plants have an especially waxy coating, to prevent water loss through the winter, when the ground is frozen and the plants are not able to access liquid water.
Our evergreen natives such as cedar, salal and oregon grape will bend when weight is added to their stems. They are able to carry snow without snapping. Other natives, such as salmonberry, snap with the weight, but they lose their leaves in the winter and so the snow will not build up on them so much.

Please note that in a class of students it is likely that one of them is at least partially colourblind (1 in 12 males are colourblind). As this is an activity distinguishing colours, these students will not be able to tell some colours apart and perceive some colours differently, although the activity will be no less interesting for them. The common red/green colour blindness means reds and greens (or colours containing reds and greens such as browns) look similar. More information at colourblindawareness.org and colorblindguide.com/post/the-advantage-of-being-colorblind.

Ask students to look through coloured plastic sheets at different coloured objects, or to view drawings they make with coloured markers. Try outdoors.
Depending on the colour of the object/marker and the colour of the filter, different features will be highlighted and will "disappear".

Explanation:
The coloured plastic takes away (absorbs) some of the colours so only one colour reaches your eyes. e.g. a red sheet absorbs all colours except red, so everything has a red tinge. If something has no red in it, it will look black.

Step by step activity to understand the phenomenon:
Ask the students to put the red filter over their eyes. Then lay out coloured papers for them to look at (don't tell the students what colours they are). Ask what colours they appear through the filters. (The red paper will look red through the red plastic; the green paper will look black through the red plastic)
Ask the students to take the plastic away so they can see the true colours of the papers. It is a very striking effect.
Discuss: the paper only reflects some colours (that is why it appears a certain colour - the other colours are absorbed). If the plastic does not let the paper colours through, the paper will appear dark.

Notes for teachers on the complexity of this activity:
Objects and filters are usually not pure emitters of one colour, so other colours nearby in the spectrum also bleed through, hence changing the final colour observed. In other words, for coloured acetate and construction paper, both the papers and the filters will allow some other colours of light through other than the colour it appears i.e. green paper will reflect yellow and blue light as well as green (they are next door on the colour spectrum), and a blue filter will allow some green light to pass - hence through a blue filter, green paper appears green and red paper appears black.
Some blue items appear purple through the red filter. The red filter is not perfect - it passes some light of other wavelengths besides red. Purple is a mixture of red and blue light - it is a non-spectral colour (violet is a spectral colour next to blue). When objects emitting blue light are seen through our red filter, both red and blue light are perceived, which look purple.

Coloured filters for astronomy studies:
Astronomers use filters to look at images of stars and galaxies, to see the phenomena they are more interested in, while making other phenomena recede. Students can look at composite images of star nurseries, nebulae or galaxies, to see the cooler gas clouds (often imaged in red, so visible through the red filter) separated from the stars and higher energy wavelengths such as X rays (often imaged in blue, so visible through the blue filter).
See this image of the sun through different filters (some wavelengths invisible to the human eye), and the sun's features that are highlighted with each filter: https://www.nasa.gov/sites/default/files/styles/full_width_feature/publ…

Coloured filters for ocean animal camouflage:
Ask students to draw an undersea scene with coloured markers, making sure that they draw some brown or black seaweed or rocks, some red and black ocean animals, and some light blue or light-coloured ocean animals.
Ask them to look through a blue filter at their scene, which mimics the lighting in ocean water (red light does not penetrate beyond 100m deep, whereas blue light reaches deeper ocean water, making the scene blue-tinted). In the blue light, which fish colours appear dark, and which fish show up lighter?
Red-coloured fish will look dark, and look the same shade as black objects. Blue and lighter coloured animals show up more brightly and are easier to see.
Ocean animals exploit this phenomenon to hide from predators: in the mid-water regions of the ocean, where only blue light penetrates, many ocean animals are coloured red or black, so that they can camouflage against dark algae and rocks or just appear dark in the water.
Light colour penetration into water:
https://s-media-cache-ak0.pinimg.com/736x/0c/c0/50/0cc050beb2c576415fd0…
Colours of ocean animals by depth: https://oceanexplorer.noaa.gov/facts/animal-color.html

Coloured filters for helping understand how other animals and some people see
Through the filters the world looks tinted and some colours look the same, and give a sense of how some animals or people with colourblindness have a different view of colours. The color vision of dogs is similar to a person with deuteranopia (red-green color blindness). Red, yellow and green are perceived as one hue. Blue and purple are perceived as a second hue. Cyan and magenta are perceived as a neutral hue (grey).